Cells were maintained within a humidified incubator at 37C in the presence of 5% CO2. molecule STAT3 or 9nAChR could be a potential target to prevent nicotine-induced chemoresistance in breast malignancy. in many cancers [2]. In breast malignancy cells, at least four different subunits (5, 7, 9, and 4) of nAChRs are known, but nicotine exposure increases mostly the expression of 9nAChR [6]. Signal transducer and activator of transcription 3 (STAT3) is usually a major transcription factor for mediating cytokine responses [7]. In response to cytokines and growth factors, STAT3 is RCGD423 usually phosphorylated at tyrosine705 by receptor-associated Janus tyrosine kinases and then forms homo- or heterodimers that translocate to the cell nucleus, where it drives transcription by binding to specific sequences. Inactivation of STAT3 in experimental animals leads to the development of several pathologies including embryonic lethality [7]. STAT3 is usually constitutively activated in human tumor cell lines and primary tumors and its constitutive activation commonly suggests poor prognosis [8, 9]. Recent studies suggest that nicotine/cigarette smoke could activate STAT3 in various pathological models including RCGD423 cancer [10C12]. Galectin-3, a member of at least fifteen -galactoside-binding soluble lectins family is usually involved in tumor cell adhesion, angiogenesis, cancer progression and metastasis [13C16]. Galectin-3 expression in gastric, liver, lung, bladder, and head and neck cancers was significantly increased compared to the normal tissues, and correlated with the progression of clinical stages and formation of metastases [17C20]. Interestingly, a change in cellular localization of galectin-3 was observed during progression of various cancers. Down-regulation of surface galectin-3 expression in colon and tongue cancers, with RCGD423 an increased cytoplasmic expression of galectin-3 at more advanced stages was reported [21, 22]. Several studies suggest that cytoplasmic galectin-3 inhibits apoptosis similar to Bcl-2 [23C25]. Resistance to apoptosis is not only essential for cancer cell survival but also for tumor progression. Conversely, secreted galectin-3 from tumor cell induces T-cell apoptosis implicating a possible role in immune escape mechanism during tumor progression [16, 23]. Several recent studies highlighted the clinical and biological significance of increased galectin-3 expression in apoptosis resistance in cancer cells in connection to targeted cancer therapies and also documented therapeutic effects of synthetic carbohydrate-based small molecule inhibitors of galectin-3 (26C29). However, studies examining the relevance of galectin-3 to nicotine and STAT3 or the possible functions of nAChR in the regulation of galectin-3 have not been reported to date. Here we present evidence that nicotine promotes galectin-3 expression in breast malignancy cells. Nicotine activated STAT3 through 9nAChR, which then promoted galectin-3 expression in breast malignancy cells. Overexpression of galectin-3 promoted chemoresistance through a nicotine dependent anti-apoptosis and an enrichment of RCGD423 side populations with cancer stem RCGD423 cell like properties. Methods Cell culture and cell transfection The breast cancer cell line MCF-7 was obtained from (ATCC) and cultured in Dulbeccos altered Eagles medium with 10% fetal bovine serum (FBS) and antibiotics. Cells were maintained in a humidified incubator at 37C in the presence of 5% CO2. Rabbit polyclonal to Protocadherin Fat 1 The transfection of cells was performed with TurboFect (Thermo Scientific) according to the manufacturers instructions. Antibodies and reagents Antibodies against phospho-(Tyr705)-STAT3 and STAT3 were purchased from Cell signaling Technologies. Antibodies against TWIST1, 9-nicotinic acetylcholine receptor (9nAChR), endo G, and galectin-3 were obtained from Aviva Systems Biology. Beta actin antibody was obtained from Sigma. Nicotine and staurosporine were purchased from Sigma. Mitotracker (mitochondrion selective probe) was obtained from Invitrogen. SiRNA of galectin-3 (Duplex no. 2, siSTABLE) beginning at nt 518, 5′-GCAAUACAAAGCUGGAUAAdTdT-3′ (sense), 5′-P UUAUCCAGCUUUGUAUUGCdTdT-3′ (antisense) was purchased from Dharmacon Research (Lafayette, CO). Galectin-3 MISSION shRNA Lentiviral Transduction Particles with target sequence CCGGGCTCACTTGTTGCAGTACAATCTCGAGATTGTACTGCAACAAGTGAGCTTTTT (Cat No. SHCLNV-“type”:”entrez-nucleotide”,”attrs”:”text”:”NM_002306″,”term_id”:”1519313657″,”term_text”:”NM_002306″NM_002306) was purchased from Sigma. Unfavorable Control Mission shRNA Transduction Particles (Cat No. SHC002V) was obtained from Sigma. Human STAT3-specific shRNAs (shRNA1-STAT3, shRNA2-STAT3, shRNA3-STAT3) were synthesized from pLKO.1 vector as previously described [30]. Target sequences of shRNA1-STAT3 (ATCTCCTGACCTTATGATCCG) are located at the 3UTR starting at nucleotide 3170 (Genbank accession no. NM003150). Target sequences of shRNA2-STAT3 (TTCTTGGGATTGTTGGTCAGC) and shRNA3-STAT3 (TTGATTCTTCGTAGATTGTGC) are located at the coding region starting at nucleotides 1663 and 728, respectively. Vector made up of scrambled shRNA was used as a negative control. Corresponding unfavorable shRNA for STAT3 is the empty vector. Mission endo-ribonuclease prepared siRNAs (esiRNAs).